27monserea 27monserea
  • 23-03-2021
  • Mathematics
contestada

A blizzard at Dairy Queen costs $3.00. Identify the independent and dependent variables.

Respuesta :

Аноним Аноним
  • 23-03-2021

Step-by-step explanation:

The idenpendent variable is the amount of blizzard we buy because we can buy any number of real blizzards and we can manipulate it to find our cost.

The dependent variable is the amont of money the blizzard cost because it depends on how many blizzard we buy

Answer Link

Otras preguntas

How are wolfs affect by living things around it?
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
what event signaled the start of the great depression in the united states
Please need help with this
What is the volume of the composite figure ?
What are the consequences of an organization not having an information policy?
Select the word(s) that should be capitalized. aunt Martha cousin mrs. professor Smith
find the value of x tangents
As we walk, we must make the pledge that we shall march ahead. We cannot turn back. There are those who are asking the devotees of civil rights, "When will you
Wich components of dna are refferd to as the genetic code