hoodieDrifts hoodieDrifts
  • 26-07-2020
  • Mathematics
contestada

Here is the feasible region.
28
А
52 + 8y 120
B
y 5
What are the coordinates of vertex A?
Enter your answer in the boxes

Here is the feasible region 28 А 52 8y 120 B y 5 What are the coordinates of vertex A Enter your answer in the boxes class=

Respuesta :

sqdancefan
sqdancefan sqdancefan
  • 05-08-2020

Answer:

  A(8, 10)

Step-by-step explanation:

Vertex A is on the vertical line x=8, so we can find the y-coordinate by solving the boundary equation ...

  5x +8y = 120

  5(8) +8y = 120 . . . use the x-value of the vertical line

  5 + y = 15 . . . . . . . divide by 8

  y = 10 . . . . . . . . . . subtract 5

Point A is (8, 10).

Ver imagen sqdancefan
Answer Link

Otras preguntas

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:
How does sugar cross the cell membrane to get into a cell
The factor tree for 1,764 is shown. What is the simplest form of 1,764? 1,764 21 42 32(72) 22(32)(72) 882 441 9 49 3 3 7
Consider the system of linear equations 2x + 3y = 8 and 3x + y=-2. Which statement is correct? O The point (1, 2) is not a solution to the system of equations b
Mrs.benson has graded 46 math asssiments but has 80% of the asssiments left to grade .
Who had reason to start the war? a. Britain, as Germany was attempted to take over parts of the British Empire. b. Russia, as their interests and rule in the Ba
Is conforming and following the crowd always a negative thing? Why or why not?
A recipe says to use 2.5 cups of flour to make 30 cookies. How many cookies can we make with 10 cups of flour?
Clouds are formed from which of the following processes: A.evaporation B.condensation C.precipitation
I need help what is 9045 times 84????