naviahbrad naviahbrad
  • 22-06-2020
  • Mathematics
contestada


Quadrilateral
Wy has vertices W. 19), X10, 10x10,2), and 32,2). Determine if quadrilateral WXYZ is a rhombus,

Respuesta :

jamjambecle jamjambecle
  • 28-06-2020

Answer: no it’s not

Step-by-step explanation:

it’s a square

Answer Link

Otras preguntas

What does Frankenstein do to make his discovery about the source of life?
what are examples of processing large data using web technologies
which of the following statements about taxes is FALSE? A-Taxes are collected a the local, state and federal level. B-Some states don't collect income tax. C-So
If two solutions differ in their [H3O+] by a factor of 2.0, the difference in their pH will be 2.0.
The answer to 5+5×5+5=
An air force plane flew to Jakarta and back. On the trip there it flew 480 km/h and on the return trip it went 288 km/h. How long did the trip there take if the
What is the most common cause of liver failure ?
Who discovered polio vaccine
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The physical environment (for example, our living spaces) that we, as individuals, create __________________. a. is unrelated to our communication b. reveals in