crowellethan
crowellethan crowellethan
  • 26-05-2019
  • Mathematics
contestada

choose the standard form of the equation of the circle with radius 5 √ 3 centered at( -6, 2) please help ​

Respuesta :

jimrgrant1 jimrgrant1
  • 26-05-2019

Answer:

(x + 6)² + (y - 2)² = 75

Step-by-step explanation:

The equation of a circle in standard form is

(x - h)² + (y - k)² = r²

where (h, k) are the coordinates of the centre and r is the radius

here (h, k) = (- 6, 2) and r = 5[tex]\sqrt{3}[/tex], hence

(x - (- 6))² + (y - 2)² = (5[tex]\sqrt{3}[/tex] )², that is

(x + 6)² + (y - 2)² = 75

Answer Link

Otras preguntas

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
how do i take disappear from here ?
An individual has a disease that reduces the amount of hemoglobin in the blood. Which of the following is most likely true of this individual? a. Oxygen delive
One of the central points in the case of U. S. V Nixon was the issue of Double Jeopardy. Question 2 options: True False.
Mick has a savings account with $800.00 in it. Every month, he withdraws $75.00 to pay for his cell phone. What is the maximum number of months that Mick can wi
Determine the number of solutions for this system of equations by inspection only. Explain.5x+4y=1335x+28y=104Select the correct answer below and fill in the an
What do cells. Need to do between divisons to make sure that s full set of dna gets passed on to each daughter cell
Simplify this expressions. 6t x 2s BRAINLIEST
Why did large family size create difficulty for the Donner party?
Please someone help me with this question