sociocynical sociocynical
  • 24-09-2018
  • Mathematics
contestada

The question is in the picture.

The question is in the picture class=

Respuesta :

beatingu
beatingu beatingu
  • 24-09-2018

it is 24 because you are adding 18 and 6 the equation is 18 - (-6)

Answer Link

Otras preguntas

What domain did sues rule?
people involved in cases that are accepted by the us supreme court must travel to washinton dc?
how are the four earths systems connected
what is similarities and differences freedmen and serfs?
Find the mean of these values 6,4,8,2,5
7.8 14. Give the inequality 7.9 15. Make d the subject of the formula: A cd Anyone know the answers to these two questions?
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
to increase an amount by 85% what single multiplier would i need to use?
1.Why is the coding sequence (whether DNA or RNA) at least three times as long as the protein sequence it codes for? 2.How can the DNA sequence be so different