badboyJah4520 badboyJah4520

22-03-2024
Geography

contestada

What human activity shapes the landscape without contributing to erosion?

Respuesta :

Otras preguntas

Packaging Solutions Corporation manufactures and sells a wide variety of packaging products. Performance reports are prepared monthly for each department. The p

F(x)= NEED HELP, I can’t remember!!

(05.01) A scale drawing of a bedroom is shown below. the scale is 1:304 inches and 3 inches show your work to determine the area of the room in square feet.

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

Write it as a mixed number please

Which index fossil in sedimentary surface bedrock most likely indicates that a marine environment once existed in the region where the sediments were deposited?

Why was class an important factor in the early 19th-century revolutions that took place in Spain's colonies in the Americas? A. Each class was assigned to a sep

Helppppppppppppppppp

Can someone please please please help me? I need this to be correct or else I’m gonna be grounded for the rest of the summer… The difference between two numbers

I would appreciate if someone could answer this